A practical reference on UV detection: what it is, how it behaves, what the literature reports, and where the honest uncertainties sit.
Reviewed 2026-04-30. Anything still debated is marked as such rather than presented as settled.
NAD+ also serves as a substrate for enzymes that cleave it, including sirtuins, PARPs, and CD38. These enzymes consume NAD+ and release nicotinamide and ADP-ribose or related products. The dual roles as redox cofactor and signaling substrate connect NAD+ to DNA repair, circadian regulation, and calcium signaling. Cellular NAD+ concentrations vary by tissue, time of day, and stress exposure. How these consumption pathways interact with redox balance remains an active area of research.
NAD+ is a dinucleotide composed of two nucleotides joined by a pyrophosphate linkage. One nucleotide contains adenine, and the other contains nicotinamide. The oxidized form carries a positive charge on the nicotinamide ring and is abbreviated NAD+. It functions as a cofactor in hydride-transfer reactions, accepting electrons in catabolic pathways. In cells, it interconverts with reduced NADH, forming a redox couple central to energy metabolism. The molecule is water-soluble and does not cross cell membranes freely without specific transport or precursor pathways.
The nicotinamide ring undergoes reversible reduction at the para position, converting NAD+ to NADH. This reaction transfers a hydride equivalent, not a free hydrogen atom or electron alone. Because the redox pair has a defined reduction potential, it links oxidation of fuels to respiratory chain activity. Many dehydrogenases use NAD+ as a co-substrate and produce NADH. The ratio of NAD+ to NADH reflects metabolic state and influences flux through several pathways.
In aqueous solution, NAD+ is most stable under mildly acidic to neutral conditions and degrades faster at high pH or elevated temperature. The molecule can hydrolyze at the pyrophosphate bond or undergo nonenzymatic cyclization. Buffers, chelating agents, and cold temperatures slow these losses during analysis. Repeated freeze-thaw cycles are generally avoided because they can promote degradation and concentration changes. Light exposure is also controlled, though NAD+ is less photolabile than some related nucleotides.
Commercial NAD+ is supplied as a solid, often as the free acid or a salt, and purity is verified by chromatographic methods. Laboratories typically store it desiccated at minus 20 degrees Celsius or below. Working solutions are prepared fresh because even sterile aqueous solutions can lose activity over hours to days depending on pH and temperature. Documentation may include a certificate of analysis, an assay value, and a recommended retest date. Researchers should verify identity and purity when results depend on precise cofactor concentrations.
| Property | Value | Notes |
|---|---|---|
| IUPAC name | Nicotinamide adenine dinucleotide | Oxidized dinucleotide form |
| CAS Registry Number | 53-84-9 | Common entry for beta-NAD+ |
| Molecular formula | C21H27N7O14P2 | Free acid form |
| Molar mass | 663.43 g/mol | Calculated for free acid |
| Water solubility | Freely soluble | Charged dinucleotide; less soluble in organic solvents |
Nicotinamide adenine dinucleotide, commonly abbreviated NAD+, is a coenzyme present in all living cells. The molecule consists of two nucleotides linked by phosphate groups, with adenine and a nicotinamide ring as its principal features. In its oxidized form, the nicotinamide ring can accept a hydride ion, becoming NADH. This reversible conversion places NAD+ at the center of many electron-transfer reactions. Its role as a redox carrier is well established across bacteria, plants, fungi, and animals.
Beyond redox chemistry, NAD+ acts as a substrate for several enzyme families. ADP-ribosyltransferases, sirtuins, and CD38 ectoenzymes cleave the molecule into nicotinamide and ADP-ribose or related products. These reactions connect NAD+ availability to processes such as DNA repair, chromatin modification, and calcium signaling. Because the coenzyme is used in both electron transfer and signaling, cells maintain separate pools in compartments including the cytosol, mitochondria, and nucleus. The relative sizes and regulation of those pools remain active areas of study.
Solid NAD+ is relatively stable when kept dry, cold, and protected from light. Aqueous solutions are more vulnerable to hydrolysis and can lose activity during repeated freeze-thaw cycles or prolonged storage at ambient temperature. Stability depends on pH, ionic strength, and the presence of degrading enzymes or metal ions. For many laboratory uses, aliquots are stored frozen and thawed only once. Exact degradation rates vary by matrix, so stability should be checked for each application rather than assumed.
Laboratory handling of NAD+ follows standard practices for hygroscopic fine chemicals. Personnel typically avoid inhalation and skin contact, use gloves and eye protection, and work in a ventilated area. Quality control may include ultraviolet absorbance at the nicotinamide maximum, chromatographic purity, water content, and identity confirmation by mass spectrometry. Because commercial preparations can contain counterions, residual solvents, or related nucleotides, a certificate of analysis helps verify the material. Researchers should confirm that the form supplied matches the intended assay.
Measuring NAD+ in biological samples requires care because the molecule is chemically reactive and present at low concentrations in some tissues. Common approaches include enzymatic cycling assays, high-performance liquid chromatography, and liquid chromatography coupled to mass spectrometry. Each method has different sensitivity and specificity, and sample preparation can affect results. Acidic or alkaline extraction steps are used in some protocols, but the choice depends on the analyte and matrix. No single method is universally optimal for every tissue or fluid.
== Pathophysiology == Overproduction of collagen is thought to result from an autoimmune dysfunction, in which the immune system starts to attack the kinetochore of the chromosomes. This would lead to genetic malfunction of nearby genes. T cells accumulate in the skin; these are thought to secrete cytokines and other proteins that stimulate collagen deposition. Stimulation of the fibroblast, in particular, seems to be crucial to the disease process, and studies have converged on the potential factors that produce this effect.
Rubidium was discovered in 1861 by Robert Bunsen and Gustav Kirchhoff, in Heidelberg, Germany, in the mineral lepidolite through flame spectroscopy. Because of the bright red lines in its emission spectrum, they chose a name derived from the Latin word rubidus, meaning "deep red". Rubidium is a minor component in lepidolite. Kirchhoff and Bunsen processed 150 kg of a lepidolite containing only 0.24% rubidium monoxide (Rb2O). Both potassium and rubidium form insoluble salts with chloroplatinic acid, but those salts show a slight difference in solubility in hot water. Therefore, the less soluble rubidium hexachloroplatinate (Rb2PtCl6) could be obtained by fractional crystallization. After reduction of the hexachloroplatinate with hydrogen, the process yielded 0.51 grams of rubidium chloride (RbCl) for further studies. Bunsen and Kirchhoff began their first large-scale isolation of caesium and rubidium compounds with 44,000 litres (12,000 US gal) of mineral water, which yielded 7.3 grams of caesium chloride and 9.2 grams of rubidium chloride. Rubidium was the second element, shortly after caesium, to be discovered by spectroscopy, just one year after the invention of the spectroscope by Bunsen and Kirchhoff. The two scientists used the rubidium chloride to estimate that the atomic weight of the new element was 85.36 (the currently accepted value is 85.47).
==== Military ==== On 26 March, it was reported that children as young as 12 years of age may join Iran's war support, leading to concerns of the use of child soldiers. Days later, rights groups stated an 11-year-old was killed while on duty at a Tehran checkpoint. On 29 March, footage showed Iraq's Popular Mobilization Forces deployed in Iran. A leaked US intelligence report concluded in May that Iran retained 70% of missile and launchers relative to pre-war status. Iran has become more skilled as the war progressed, learning how to evade American air defenses. Iran managed to extend the conflict to include most of the Middle East and enlisted allied militia in Iraq and Yemen.
A study on the evolution of incisors of Eocene-Oligocene muroid rodents from Balkanatolia is published by van de Weerd et al. (2026). Lopatin (2026) describes fossil material of members of the family Platacanthomyidae from the Pleistocene strata from Vietnam, including the first known fossil material of the Chapa pygmy dormouse and Typhlomys taxuansis. Rico & Terry (2026) identify skull traits that are best predictors of body length and weight of pack rats and reconstruct the evolution of body size of pack rats from the Paisley Caves (Oregon, United States) throughout the past 15,000 years. Baca et al. (2026) reconstruct the evolutionary history of the field vole species complex based on data from modern mitogenomes and nuclear genomes and from ancient genomes of specimens spanning the last 75,000 years. Alfaro-Ibáñez et al. (2026) study mitochondrial genomes of Pleistocene tundra voles from the El Mirón Cave (Spain), and identify a novel, extinct southern European haplogroup within this species. Evidence from the study of molars of Stenocranius anglicus (European narrow-headed vole) from Middle Pleistocene to Holocene localities in Czech Republic and Slovakia, indicative of more pronounced morphological variation between populations from different sites than between stratigraphic stages and of long-term survival of the species in isolated populations, is presented by Dubjelová et al. (2026). Desclaux et al.
Sources: en.wikipedia.org
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
Spironolactone can also have numerous other interactions, most commonly with other cardiac and blood-pressure medications, for instance digoxin. Licorice, which has indirect mineralocorticoid activity by inhibiting mineralocorticoid metabolism, has been found to inhibit the antimineralocorticoid effects of spironolactone. Moreover, the addition of licorice to spironolactone has been found to reduce the antimineralocorticoid side effects of spironolactone in women treated with it for hyperandrogenism, and licorice hence may be used to reduce these side effects in women treated with spironolactone as an antiandrogen who are bothered by them. Conversely, spironolactone is useful in reversing licorice-induced hypokalemia. Aspirin and other NSAIDs have been found to attenuate the diuresis and natriuresis induced by spironolactone, but not to affect its antihypertensive effect. Some research has suggested that spironolactone might be able to interfere with the effectiveness of antidepressant treatment. As the medication acts as an antimineralocorticoid, it might be able to reduce the effectiveness of certain antidepressants by interfering with normalization of the hypothalamic–pituitary–adrenal axis and by increasing levels of glucocorticoids such as cortisol. Other research contradicts this hypothesis and has suggested that spironolactone might produce antidepressant effect, for instance, in studies showing antidepressant-like effects of spironolactone in animals.
He also said that the government would also target 86 more people and companies connected to President Putin, including people who were "actively undermining the impact of existing sanctions". Sunak said that the new sanctions were made to ensure Russia paid "a price for its illegal activity" and urged other G7 countries to follow suit. The United States also announced that it would tighten export controls to Russia, particularly with regard to militarily important goods, and impose nearly 300 new sanctions against targets linked to Russia. Canada also imposed sanctions on targets linked to the Russian military, relatives of listed persons, members of the Kremlin elite, and those involved in human rights violations. In response to these sanctions, the Russian Foreign Ministry announced a ban on entry into the country on 500 Americans including former President Barack Obama, comedians Stephen Colbert, Jimmy Kimmel and Seth Meyers, Senators JD Vance, Katie Britt and Eric Schmitt, former US Ambassador Jon Huntsman Jr., presumptive Chairman of the Joint Chiefs of Staff General Charles Q. Brown Jr. and several journalists of CNN. Also included were officials involved in the prosecution of participants in the United States Capitol attack in 2021. It also continued to deny US consular access to detained journalist Evan Gershkovich in retaliation for the blocking of entry to Russian journalists during Foreign Minister Sergei Lavrov's visit to the UN in New York in April 2023.
Sources: en.wikipedia.org
== History == "During the 17th and 18th centuries, various forms of immunotherapy in cancer became widespread... In the 18th and 19th centuries, septic dressings enclosing ulcerative tumours were used for the treatment of cancer. Surgical wounds were left open to facilitate the development of infection, and purulent sores were created deliberately... One of the most well-known effects of microorganisms on ... cancer was reported in 1891, when an American surgeon, William Coley, inoculated patients having inoperable tumours with [ Streptococcus pyogenes ]." "Coley thoroughly reviewed the literature available at that time and found 38 reports of cancer patients with accidental or iatrogenic feverish erysipelas. In 12 patients, the sarcoma or carcinoma had completely disappeared; the others had substantially improved. Coley decided to attempt the therapeutic use of iatrogenic erysipelas..." "Coley developed a toxin that contained heat-killed bacteria [ Streptococcus pyogenes and Serratia marcescens ]. Until 1963, this treatment was used for the treatment of sarcomas." "Coley injected more than 1000 cancer patients with bacteria or bacterial products." "51.9% of [Coley's] patients with inoperable soft-tissue sarcomas showed complete tumour regression and survived for more than 5 years, and 21.2% of the patients had no clinical evidence of tumour at least 20 years after this treatment..." Research continued in the 20th century under Maria O'Connor Hornung at Tulane Medical School.
=== Death === The Culture has a relatively relaxed attitude towards death. Genetic manipulation and the continual benevolent surveillance of the Minds make natural or accidental death almost unknown. Advanced technology allows citizens to make backup copies of their personalities, allowing them to be resurrected in case of death. The form of that resurrection can be specified by the citizen, with personalities returning either in the same biological form, in an artificial form (see below), or even just within virtual reality. Some citizens choose to go into "storage" (a form of suspended animation) for long periods of time, out of boredom or curiosity about the future. Attitudes individual citizens have towards death are varied (and have varied throughout the Culture's history). While many, if not most, citizens make some use of backup technology, many others do not, preferring instead to risk death without the possibility of recovery (for example when engaging in extreme sports). These citizens are sometimes called "disposables", and are described in Look to Windward. Taking into account such accidents, voluntary euthanasia for emotional reasons, or choices like sublimation (abandoning physical reality), the average lifespan of humans is said in Excession to be around 350 to 400 years. Some citizens choose to forgo death altogether, although this is rarely done and is viewed as an eccentricity.
== Blood tests == Bilirubin is degraded by light. Blood collection tubes containing blood or (especially) serum to be used in bilirubin assays should be protected from illumination. For adults, blood is typically collected by needle from a vein in the arm. In newborns, blood is often collected from a heel stick, a technique that uses a small, sharp blade to cut the skin on the infant's heel and collect a few drops of blood into a small tube. Non-invasive technology is available in some health care facilities that will measure bilirubin by using a bilirubinometer which shines light onto the skin and calculates the amount of bilirubin by analysing how the light is absorbed or reflected. This device is also known as a transcutaneous bilirubin meter. Bilirubin (in blood) is found in two forms:
. Aston's early model of nuclear structure (prior to the discovery of the neutron) postulated that the electromagnetic fields of closely packed protons and electrons in the nucleus would interfere and a fraction of the mass would be destroyed. A low packing fraction is indicative of a stable nucleus.
Sources: en.wikipedia.org
NAD+ is the oxidized form, while NADH is the reduced form carrying an added hydride. The two form a redox pair that cells use in many energy-yielding reactions.
NAD+ is a small organic cofactor, not a protein or enzyme. It binds temporarily to enzymes such as dehydrogenases to assist electron transfer.
Intact NAD+ is generally not taken up efficiently by most cells because it is charged and water-soluble. Cells often rely on precursors such as nicotinamide or nicotinamide riboside to produce NAD+ internally.
NAD+ and NADH can interconvert quickly after a sample is collected, which can alter the measured ratio. Rapid quenching and cold handling limit enzymatic and chemical changes.